Impedance Spectroscopy Measurements Research Articles

Formulating Interfacial Impedances for Designing High-Energy and High-Power All-Solid-State Battery Cathodes.

All-solid-state batteries (ASSBs) are safe, high-energy-storage systems. However, despite the progress achieved in the development of high-ionic-conductivity solid electrolytes (SEs), the power performance of ASSBs remains low because of the high interfacial impedances in composite cathodes. Therefore, understanding the interfacial factors is crucial for obtaining high power ASSBs. This study provides a quantitative analysis of the influence of these factors using impedance spectroscopy measurements, which enables the elucidation of the interfacial impedance values of two key parameters, the grain-boundary resistance (ri,gb) and charge-transfer resistance (ri/e). Systematic investigation revealed an unexpected increase in the cathodic resistance with the decrease in the size of the cathode active material (CAM) particles, indicating that even high-reaction-surface-area CAMs yield low ri/e but high ri,gb values owing to their high porosity, resulting in a trade-off relationship. In contrast, this phenomenon is unlikely to occur in liquid-electrolyte-based batteries. Notably, we discuss how composite cathode design impacts performances of stable, high-power, and high-energy ASSBs.

Synthesis and study of the inhibitory properties of a new Schiff base for C45 carbon steel in 1 M HCl

A newly Schiff base 1, 13-bis-[(4-dimethylamino) benzaldehyde 4, 7, 10-trioxatridecane-diimine] (DABT) was synthesized and characterized on the basis of the results of FT-IR, mass spectroscopy (MS), 1HNMR and 13CNMR. The desired performance of the organic compound DABT which is easy, inexpensive to prepare and eco-friendly, as a corrosion inhibitor for C45 carbon steel in 1 M HCl medium was evaluated using weight loss, potentiodynamic polarization, electrochemical impedance spectroscopy (EIS) measurements. The results suggest that the corrosion inhibition effectiveness increases with increasing inhibitor concentration and decreases with increasing temperature. The polarization experiments demonstrate that DABT exhibits the characteristics of a mixed-type inhibitor and follows the Langmuir isotherm in its adsorption behavior. Contact angle measurement revealed that the inhibitor on the surface of the carbon steel is hydrophobic. The synergistic effect of DABT has been investigated; inhibitory efficiency rises with increasing concentration of KI by competitive adsorption to form a layer of protection on the metal surface. Energy dispersive X-ray spectroscopy (EDS) combined with scanning electron microscope (SEM) was utilized to interpret the morphological study of the carbon steel surface. A good correlation was found between theoretical [Density functional theory (DFT), molecular dynamics simulation (MDS)] and experimental findings.

Optimizing Structural Patterns for 3D Electrodes in Lithium-Ion Batteries for Enhanced Fast-Charging Capability and Reduced Lithium Plating

The most common pattern types for anode structuring, in particular the line, grid, and hexagonal-arranged hole pattern were evaluated in a comparable setup in full-cells and symmetrical cells. The cells with structured electrodes were compared to reference cells with unstructured anodes of similar areal capacity (4.3 mAh cm−2) and the onset of lithium plating during fast-charging was determined in situ by differential voltage analysis of the voltage relaxation and ex situ by post-mortem analysis. Furthermore, electrochemical impedance spectroscopy measurements on symmetrical cells were used to determine the ionic resistance of structured and unstructured electrodes of similar areal capacity. All cells with structured electrodes showed lower ionic resistances and an onset of lithium plating shifted to higher C-rates compared to cells with unstructured electrodes. The structure patterns with capillary structures, i.e., lines and grids, showed significant reduced lithium plating during fast-charging and a higher rate capability compared to reference cells with unstructured electrodes and cells with hole structured electrodes. The continuous rewetting of the electrode with liquid electrolyte by capillary forces and the reduced ionic resistance of the 3D electrode are identified as key factors in improving overall battery performance. The data of the studied cells were used to calculate the resulting energy and power densities of prospective commercial pouch cells and potential pitfalls in the comparison to cells with unstructured electrodes were identified.

Humidity impact on polarization dynamics in polymer electrolyte membrane fuel cells through distribution of relaxation times analysis

The interaction among relative humidity, current density, and internal polarization plays a crucial role in optimizing the performance of polymer electrolyte membrane fuel cells (PEMFCs). However, achieving swift analysis and feedback on the internal humidity status of PEMFCs through on-vehicle impedance spectroscopy measurements remains a significant challenge. Conducting a series of impedance spectra under operating conditions of 30 %, 50 %, and 80 % relative humidity sheds light on the impact of humidity on performance. Correlations between specific distribution of relaxation times (DRT) peaks and internal polarization are established. Through DRT analysis, four polarization dynamics related to proton transfer at the proton exchange membrane interface, proton transport in the cathode catalyst layer, charge transfer, and the oxygen diffusion process are effectively identified based on characteristic frequencies and peaks. The rate-determining step of the polarization varies under idling, rated, and overload conditions, providing valuable insights. This study contributes analytical models and strategic guidance for tailoring relative humidity conditions to mitigate polarization, thereby enabling real-time control and enhancement of PEMFC performance.

Corrosion behavior analysis of steel in simulated carbonated concrete pore solution based on 3D optical microscopy method

The main purpose of this study was to analyze the corrosion behavior of steel in simulated carbonated concrete pore solution (SCCPS) with the help of 3D optical microscopy method. This method was adopted to provide qualitative observation of surface with 3D information and quantitative results of defects for steel which was affected by various NaCl contents and inhibitors (inorganic inhibitor (NaNO2) and organic inhibitor (DEA(C4H11NO2)). As the NaCl contents changed during all corrosion periods, the mean pitting depths (Ra) and NaCl contents showed stronger linear relationships, and the slop values presented as the Ra added value of per wt% for different inhibitor systems were all detected to be closed to 3 μm/wt% in all linear regression models. This method provided a new angle to investigate and estimate the defect variation on steel surface, which denoted to better understand the corrosion behavior in SCCPS. Additionally, electrochemical impedance spectroscopy (EIS) and weight loss measurements were also used to verify the results of 3D optical microscopy analysis.

Dielectric And Mechanical Properties Of PLA-Carbon Composites

This study focuses on the development and characterization of Carbon-based Polylactide (PLA) composites for 3D printer filaments. The aim is to enhance the electrical and mechanical properties of PLA by incorporating recovered carbon black (RCB) in different mesh sizes (500, 1000, 1500, and 2000 mesh). Electrical impedance spectroscopy and dielectric constant measurements were performed to investigate the electrical properties of the composites. Results showed that the addition of RCB increased the dielectric constant, with values ranging from 2.5 to 7.1, indicating improved electrical performance. Scanning electron microscopy (SEM) analysis revealed the dispersion of carbon particles within the composites, enhancing their electrical conductivity. The effect of RCB particle size on electrical properties was also explored, with smaller particle sizes (2000 mesh) resulting in the highest conductivity of 6.2 S/m. Tensile testing demonstrated that the addition of RCB increases the tensile strength of PLA, with values ranging from 28.6 MPa to 47.2 MPa, and the elastic modulus, ranging from 832 MPa to 1.56 GPa, depending on the mesh size. The optimal combination of RCB content and mesh size resulted in a composite with a tensile strength of 43.8 MPa. Overall, this research provides insights into the development of Carbon-based PLA composites with improved electrical and mechanical properties.

Degradation behavior and osteogenic activity of octacalcium phosphate modified MgO coatings on magnesium

To further enhance the corrosion resistance and osteogenic activity of the porous micro-arc oxidation (MAO) derived MgO ceramic coating on biomedical magnesium (Mg), octacalcium phosphate (OCP) layers with different microstucture were prepared on MAO coating by chemical deposition (CD) method to fabricate MAO/CD composite coatings. The in vitro degradation behaviors of MAO/CD-coated samples were evaluated by immersion in simulated body fluid (SBF) and electrochemical impedance spectroscopy (EIS) measurement. Their effects on in vitro MC3T3-E1 cell differentiation were investigated by examining alkaline phosphatase (ALP) activity and expression of main osteogenic-related genes. The in vitro immersion tests show that MAO/CD coatings rarely experience destruction and only micro-cracks occur after 96 h. EIS tests indicate that MAO/CD coatings slow down the degradation rate of Mg observably. In addition, MAO/CD coatings improve osteogenic differentiation of MC3T3-E1 cells compared to MAO coating, which is ascribed the lightened alkalization of the surrounding medium as well as up-regulated intracellular Ca2+. MAO/CD coating deposited in 2 h endows Mg the slowest degradation rate and excellent osteogenic differentiation induction activity.

In2S3 nanoparticles modify the porous Fe2V4O13 nanostructure photoanode to enhance charge separation efficiency and photoelectrochemical water splitting performance

In this study, we demonstrate for the first time a promising photoanode of Fe2V4O13/In2S3 (FVO/IS) nanoparticles (NPs) for photoelectrochemical (PEC) water splitting. Most importantly, this work presents the first application of X-ray photoelectron spectroscopy in tracking electron flow direction within FVO/IS to reveal the formation of heterojunction having the electron flow from IS to FVO. Mott-Schottky measurement confirms that the modification of IS NPs establishes the type II heterojunction between FVO and IS, favorable for the transport and separation of carriers. Spectral measurements of electrochemical impedance spectroscopy, photoluminescence and Bode diagram confirm the effective separation of carriers and the prolongation of the charge lifetime in the FVO/IS heterojunction photoanode. Moreover, the electrochemical measurements evidently demonstrate the substantial enhancement in the charge separation efficiency (ηseparation) and charge transfer efficiency (ηtransfer) of the photoanode, leading to significantly enhanced PEC water splitting capability. As a result, in contrast with the pure FVO NPs photoanode, the photocurrent density of the constructed FVO/IS NPs photoanode is increased by 27 times without bias. This study paves a new approach for boosting the PEC water splitting activity of FVO photoanodes by constructing heterostructures through modification with other semiconductors.

Electrochemical characteristics of nano-structure TiCN coatings on the tool steel deposited by PACVD in various solutions

This study investigates The electrochemical behavior of various nano-structure TiCN coatings prepared using a plasma-assisted chemical vapor deposition technique in acidic and alkaline solutions. The N2/Ar ratio was varied to explore its effect on the microstructure and electrochemical properties of coatings on the steel cold-work tool. Electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization (PP) measurements were carried out in various corrosive solutions. Field emission scanning electron microscopy and X-ray diffraction were also utilized to evaluate the microstructure and phase detection. The EIS results showed that the resistance of TiCN coatings increased by about 94.3 % based on the equiaxed structure and small size of the coating cluster in 3.5 % wt NaCl solution after 24 h. The lowest corrosion rate with a value of 5.9 µA cm−2 in Ringer's solution at 37 °C after 24 h was attributed to the TiCN coating with the N2/Ar ratio of 0.4 according to exhibiting the highest Ti content and changes in present phases. The N2/Ar ratio of 0.7 effectively increased the impedance resistance to 97.5 % based on PP test results in 3 M H2SO4 solution. This behavior was related to the lowest value of the C/N ratio and the highest coating thickness.

In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 – 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

Use of a natural rock material as a precursor to inhibit corrosion of Ti alloy in an aggressive phosphoric acid medium

The mechanism of interaction between magnesite mineral and phosphoric acid (0.001–0.5 M) in addition to the determination of the protective properties for Ti alloy (working electrode) in phosphoric acid both with and without an inhibitor have been investigated by electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization measurements. Results of electrochemical tests show that the corrosion resistance of titanium alloy in phosphoric acid solution only increased and hydrogen production decreased by either decreasing acid concentration or increasing immersion time associated with the thickening of the oxide film formed on the alloy surface. On adding magnesite, the corrosion resistance of Ti alloy is enhanced by increasing the phosphoric acid concentration (0.001–0.5 M) due to the formation of sparingly soluble magnesium phosphate film on the alloy surface that inhibits the effect of increasing hydrogen evolution reaction due to the pH value decreases. The increasing adsorption behavior of the magnesite inhibitor and decreasing its diffusion were deduced from EIS measurements. Thus, the addition of 3% magnesite minimizes the corrosion by forming a new protective film (Mg3(PO4)2), which differs from the traditional passive film and prevents the effect of the increase of hydrogen evolution. The surface morphology and chemical composition of the tested alloy were determined using scanning electron microscopy (SEM), Fourier transform Infra-Red spectroscopy (FTIR), X-ray diffraction (XRD), X-ray Fluorescence (XRF) and In situ Raman spectroscopy.

Effect of recrystallization degree on properties of passive film of super ferritic stainless steel S44660

Abstract The effect of the recrystallization degree on the properties of passive films formed in 0.1 M HNO3 solution for super ferritic stainless steel S44660 was examined in this study. The initial specimens, in their cold-rolled state, showed a high dislocation density, as observed through electron backscatter diffraction (EBSD) experiments. Analysis of potentiodynamic polarization (PDP) curves and electrochemical impedance spectroscopy (EIS) measurements suggested that with the increase of recrystallization degree, the corrosion current density reduced and the corrosion potential increased. As revealed by Mott–Schottky analysis, the passive film showed a dual structure of n-type and p-type semiconductors, with the carrier density of the passive film decreasing as the recrystallization degree increased. X-ray photoelectron spectroscopy (XPS) provided insights into the film composition, indicating that the Fe2O3 and Cr2O3 content, which improved the stability of the passive film, increased with the degree of recrystallization. In summary, the increase in recrystallization degree reduced the number of defects in the microstructure, thereby creating favorable conditions for the formation of highly protective passive films. The passive film formed after complete recrystallization exhibited enhanced corrosion resistance.

Flexible ceramic based ‘paper separator’ with enhanced safety for high performance lithium-ion batteries: Probing the effect of ceramics impregnation on electrochemical performances

Cellulose is now considered as an appealing environment friendly material for the development of sustainable separators for rechargeable batteries. This study thus aims to develop high performance paper based ceramic separators with superior electrolyte wettability (>170 %), high thermal stability (>200 °C) and excellent flame safety. While developing paper based ceramic separator, extensive studies are carried out to understand thenature and functionality of different nano-structured ceramic materials (Al2O3, BaTiO3 and ZrO2) impregnated in paper matrix. Nano-ZrO2 facilitates an effective pathway for Li +-ion transport (tLi+ = 0.51), whereas BaTiO3 and Al2O3 ceramics show moderate Li +-ion transport properties (tLi+ of 0.29 and 0.30 respectively). Electrochemical Impedance Spectroscopy (EIS) measurement clearly reveals that ZrO2 exhibits more interfacial compatibility with the electrodes (MCMB and LiNi1/3Mn1/3Co1/3O2) compared to the other two ceramic separators during full cell operation. The developed paper separators show excellent electrochemical properties in terms of cycling (tested 300 cycles), multi-electrode compatibility and rate capabilities at different current densities of 0.1–1.2 mAcm−2. The pre- and post-electrochemical EIS data reveal that ZrO2 based impregnation offers significantly lower charge transfer resistance compared to the other two separators. The study thus demonstrates a real promise for its successful application in Li-ion battery towards achieving sustainability and safety.

Thiourea modulated supercapacitive behavior of reduced graphene oxide

In this report, we investigated the role of the concentration of nitrogen and sulfur containing thiourea in modulating the electrochemical properties of reduced Graphene Oxide (rGO) by controlling the percentage of heteroatoms on the rGO surface. The synthesis route involved the preparation of Graphene Oxide (GO) using an improved method of synthesis in an economical way by reducing the volume of concentrated acids used. Furthermore, GO is reduced by using different mass proportions of thiourea via a simple reflux method. Characterization of the rGO samples by Fourier Transform Infrared (FTIR) spectroscopy, Raman spectroscopy, X-ray Diffraction (XRD), Scanning Electron Microscopy with Energy Dispersive X-ray Spectroscopy (SEM-EDAX) and elemental analysis through CHNS analyzer exhibited successful doping and impact of nitrogen and sulfur atoms on the graphene framework. The comparative electrochemical performance from Cyclic Voltammograms (CV), Galvanostatic Charge Discharge (GCD) profiles and Electrochemical Impedance Spectroscopy (EIS) measurements on the various rGO samples revealed the superiority of 1:8rGO having 15.190 wt% of nitrogen and 26.849 wt% of sulfur and S/N ratio of 1.768, in delivering highest specific capacitance of 465.21 F·g−1 at 1 mV·s−1 scan rate with a remarkable cyclic stability exhibiting a capacitive retention of 119 % and offering lowest charge transfer resistance and diffusion resistance. The study also demonstrated detrimental effect of excess thiourea on electrochemical properties of rGO. This work suggests an effective and simple approach for optimizing the nitrogen and sulfur content in rGO to enhance its electronic properties using thiourea.

Schematic diagram illustrating the corrosion reaction in Mg–Li–Al–Ca alloy with and without β-Li phase

The effect of Li on the microstructure and corrosion behavior of extruded Mg-xLi-3Al-0.4Ca (x = 4,5,6,7) alloys were investigated by hydrogen evolution, potentiodynamic polarization measurement and electrochemical impedance spectroscopy measurement. The single-phase 4Li alloy with the largest α-Mg grain size and the strongest basal texture intensity exhibits the best corrosion resistance in 3.5 wt% NaCl solution. The duplex 6Li and 7Li alloys contain a protective LiOH film in the corrosion products, giving them better corrosion resistance than 5Li alloy. This study provides a new insight for the design and preparation of Mg–Li alloys with high corrosion resistance.

Novel, compact electrochemical and impedance instrumentation

This paper presents the development of a novel, compact electrochemical and impedance instrumentation utilizing an analog integrated circuit (IC) for biosensing applications. Given the increasing availability of multifunctional integrated circuits (ICs), there is a growing need for devices capable of versatile applications spanning multiple fields. To address this requirement, a design was tailored to accommodate multifunctional techniques for biosensing. By combining multi-layer printed circuit board (PCB) techniques with 3D printing, the module was compact and capable of cyclic voltammetry (CV) and electrical impedance spectroscopy (EIS) measurements. Additionally, a comparison was conducted between the CV functionality of a commercial and the customized module. The results demonstrated that the customized module outperformed the commercial module. The Bode and Nyquist plots obtained from the EIS measurements accurately depicted the impedance values of resistance (R) and capacitance (C) in basic RC circuits. The experimental results show the error of R was below 2% and C was below 4% across the full frequency range from 500 Hz to 10 kHz. Furthermore, the high performance of this system was demonstrated by its successful application in monitoring the ripeness of bananas through EIS measurements. These measurements specified the total impedance and phase to assess the ripening stages accurately. This suggests the potential of the proposed system for utilizing impedance measurements in controlling fruit quality. Based on the achieved results, the proposed system holds promise for various electrochemical research and monitoring applications, particularly for electrochemical sensors and biosensors.

Novel Ce(OH)CO3/carbon nanotubes hybrid material towards a highly sensitive electrochemical dopamine determination in real urine samples

Cerium hydroxycarbonate and multiwalled carbon nanotubes (Ce(OH)CO3/CNT), drop-casted onto a glassy carbon (GC) electrode and electrochemically treated (tCe(OH)CO3/CNT) has been obtained as a new hybrid material. tCe(OH)CO3/CNT was characterized through SEM, FT-IR, UV–Vis, and electrochemical techniques such as cyclic voltammetry (CV) with different redox couples as Fe2+/3+, Fe(CN)63-/4− or Ru(NH3)62+/3+and electrochemical impedance spectroscopy (EIS) measurements with Fe(CN)63-/4−. The charge transfer resistance (RCT) value of tCe(OH)CO3/CNT was up to two orders of magnitude lower than the RCT of bare GC electrodes and these results were confirmed by the effective heterogeneous electron transfer rate constant values (k°eff, 2.4 10−3 vs 7.0 10−4, respectively). The calibration curve of DA exhibits a linear response within the range of 0.1 and 70 μmol L−1 with a correlation coefficient (R2) of 0.987 (n = 3) and a limit of detection of 0.003 μmol L−1. Inorganic and organic interferents do not alter significatively the selectivity. The electrochemical treatment of Ce(OH)CO3 and CNT generates a modified electrode which successfully combines the selectivity of Ce towards catechol with the high conductivity of CNT presenting an ideal performance for the electrochemical DA determination in 5 real urine samples (1.94 μmol L−1 in a 1:20 dilution) using differential pulse voltammetry (DPV) with an RSD < 6.1 %.

Phosphoric Acid Activation of Titanium-Supported Lead Dioxide Electrodes for Bipolar Battery Applications

Abstract Titanium foil coated with doped tin dioxide is an attractive option for the positive current collector interface of bipolar lead batteries due its corrosion resistance and mechanical performance. The phosphoric acid and two of its derivatives, one inorganic (calcium hydrogen phosphate) and one organic (poly-vinylphosphonic acid), have been studied as additives with potential for improvement of the capacity retention of such positive electrodes. The results show that the jar-formation process of the electrodes in the sulfuric acid electrolyte containing phosphoric acid successfully overcomes the capacity retention problem at all studied cases. This leads also to considerable improvement of the lead dioxide utilization. The cycling ageing of the electrodes combined with periodic impedance spectroscopy measurements, indicate progressive capacity loss corresponding to the typical processes of degradation of the lead dioxide structure. Rather small changes in the electrode resistance prove the corrosion and the passivation resistance of the current collectors. It is concluded that the combined doping with phosphoric acid species in the electrolyte and in the positive paste offers a potential for further improvements of the electrodes cyclability.

Achieving ultrafine lamellar structure and exceptional electrochemical properties of Fe35Mn27Ni28Co5Cr5 high-entropy alloy through severe cold rolling process

This research provides an insight into the effect of ultrafine lamellar microstructures on the electrochemical behavior of Fe35Mn27Ni28Co5Cr5 high-entropy alloys (HEAs) in a 0.5 M H2SO4 solution. Following the severe cold rolling (SCR) process at a reduction rate of 90 %, the Fe35Mn27Ni28Co5Cr5 alloy exhibited a predominantly lamellar microstructure aligned along the rolling direction, leading to variations in grain size and subsequent differences in electrochemical behaviors. The potentiodynamic polarization (PDP) plots and electrochemical impedance spectroscopy (EIS) measurements confirmed that the influence of heavy cold rolling on corrosion resistance was mainly attributed to grain refinement and residual stress. The corrosion resistance of HEAs was ameliorated as a result of increased rolling deformation. The 90 % cold-rolled specimen showed excellent comprehensive corrosion resistance, for which the Ecorr and icorr values were found to be −0.278 V and 329 µA/cm2. Consequently, the development of ultrafine lamellar structures provides better conditions for forming passive films with higher protection behavior compared with their other counterparts. It could be due to the improved surface conditions for the development of oxide films resulting from higher homogeneity. The present work will provide new opportunities for tailoring the electrochemical characteristics of HEAs with strong commercial viability.

Detailed DFT/MD simulation, QSAR modeling, electrochemical, and surface morphological studies of self-assembled surfactants as eco-friendly corrosion inhibitors for copper in 1 M HNO3 solution

Three novel self-assembled phenyl pyrazole cationic surfactant derivatives, coded as SA-6, SA-12, and SA-18, were synthesized, structure confirmed, and examined as eco-friendly corrosion inhibitors for Cu in 1 M HNO3 electrolyte using open circuit potential (OCP), potentiodynamic polarization (PDP), and electrochemical impedance spectroscopy (EIS) measurements. The efficacy of these surfactants was pointedly influenced by dosage (5 × 10−5 M − 1 × 10−3 M), attaining a maximum of 90.9 %, 92.9 %, and 94.5 % for SA-6, SA-12, and SA-18, respectively, at 1 × 10−3 M. The fact that the highest shift in corrosion potential (Ecorr) is so minor suggests that the compounds under investigation are inhibitors of the mixed type (anodic/cathodic). The high value of Kads and the negative ΔGadso value (−35.0, −35.8, and −36.8 kJ mol−1) suggests that the SA-6, SA-12, and SA-18 inhibitors have a strong and spontaneous tendency to adsorbed onto the Cu substrate. The development of the self-assembled surfactant defensive film on the Cu substrate was morphologically verified by atomic force microscopy (AFM). The studied self-assembled surfactants adsorbed physically and chemically according to Langmuir isotherm model. Quantitative structure–activity relationship (QSAR) was used to construct the prediction model for SA-6, SA-12, and SA-18′s anti-corrosion properties, while density functional theory (DFT) calculations were used to determine the chemical descriptors linked to the frontier molecular orbitals (FMOs). It was shown that the results of the computational and electrochemical experiments were highly consistent.